Isolation, Characterization and Evaluation of Endophytic Fungal Extracts of Bacopa monnieri Linn (Leaves) for In Vitro Antioxidant Activity

Introduction

Endophytes are microbes, which are found in various internal parts of the plant. The first endophytes were identified by Freeman in 1904, who analysed an endophytic fungus in annualgrass.¹ The environment which get inside the plant will help to grow microorganisms. Endophytes remain inside the plant, without effecting the plants, but are able to releasenew secondary metabolites that may or may not present in that of parent plants.² Endophytes give protective atmosphere that helps with increased varieties from indigenous microbial communities to a possibly exploitable bacteria/fungi. Endophytic bacterial and fungal species were evaluated for antibacterial,³ cytotoxicagents, antioxidants, ⁴ antidiabetic,and anti-immunosuppressive agents.⁵

Bacopa monnieri (Brahmi) (Scrophularaceae) is anancientdrug of medicine in India, which includes mainly Bacoside A and B (saponin mixture), Becogenin A1 and A2, Bacopasaponin D, Pseudojujubogenin, Hersaponin, Monnierin, Brahmine^6,7,8 as important phyto constituents. Bioactive is ochromenone were separated from Aspergillus fumigatus, Endophytic Fungus from Bacopa monnieri, ⁹ new saponin glycosides, 3-O-[6-O-sulfonyl-β-d-glucopyranosyl-(1→ 3)]-α-l-arabinopyranosyl pseudojujubogenin (1) and 3-O-[α-l-arabinofuranosyl-(1→2)]-α-l-arabino pyranosyl jujubogenin (2), a new matsutaka alcohol derivative, (3R)-1-octan-3-yl-(6-O-sulfonyl)-β-dglucopyranoside (3), a new phenylethanoid glycoside, 3,4-dihydroxyphenylethyl alcohol (2-O-feruloyl)-β-d-glucopyranoside (4), and a new glycoside, phenylethyl alcohol [5-O-p-hydroxy benzoyl-β-d-apiofuranosyl-(1→2)]-β-d-gluco pyranoside (5), were separated from Bacopa monnieri. Their structures were confirmed by NMR, MS, and chemical methods.¹⁰ N1 biosynthetic potential of endophytic Aspergillus sp. BmF¹⁶ were separated from Bacopa monnieri. ¹¹ Surfactin, iturin, and fengycin were biosynthesized by endophytic Bacillus sp. from Bacopa monnieri. ¹² Bacopa containing active components like bacosides helps in production of the neurotransmitter, Serotonin; Bacopa helps to maintain neurotransmitter balance.¹³ Bacoside containing Bacopa monniericoncentratereduces morphine hyperactivity andraised striatal dopamine.¹⁴ Latest survey of Bacopa monnieri and its componentswere used for treating anxiety, depression and cognitive functions,^15,16 neuroprotective effects,¹⁷ anti-ulcer,¹⁸ human memory,¹⁹ antioxidant, and hepatoprotective.²⁰

There is no scientific evidence to justify the traditional usage of Bacopa monnieri leaves from endophytic community in the management of oxidative stress which is caused by the free radicals. Hence, the present work was undertaken to isolate, characterize, and to evaluate its antioxidant effect in in vitro experimental models.

Materials and Methods

Collection and Authentication of Plant

The plants were collected in the vicinity of Dharwar district during June-2016 and were authenticated by the renowned botanist.

Isolation of Endophytic Fungi from Bacopa monnieri

Leaves of the Bacopa monnieri were carefully cleaned with distilled water and then sterilized on the area from 90% ethanol followed by treatment with 4% sodiumhypochlorite solution for 30 seconds to 1 minute. For the preparation of culture media, petridish were collected and washed properly then they were rinsed with alcohol and left for drying. Two conical flasks of 250 mL were taken and to it 4g of potato dextrose agar(PDA) and 25 mg of streptomycin were added to each flask and they were dissolved in 100 mL of distilled water in each flask. For proper solubility the flasks were kept in water bath for 5 m. The mouth of flask was closed tightly. The petridish and the conicalflask were collected and kept in autoclave for moist heat sterilization for 1 h. All the required materials were taken into laminar airflow chamber. The PDA solution were placed in petridish and left for 10 m to solidify. After the broth media is properly solidified then plant parts were separately embedded in the media in 3 petridish. The petridish were closed with cover plate and kept in incubator for further growth of endophytic fungi at 25-26^o C for 7 days. After 7 days, growth of endophytes was noticed then they were subjected to subculture technique to get pure fungal strain.^21-24 

Subculturing Technique

Broth media were prepared using PDA (Potato dextrose agar). Petridish and PDA solution were sterilized by autoclaving for 120^o C for 15-20 min. Small sections of grown endophytic fungi were transferred into media for proper growth. Transfer of endophytic fungi was done with flame sterilized inoculating loop by striking and kept for 7 days in the incubator at 25-26^o C. Following, incubations for 7 days, the fungi which were grown on PDA solidified media and were sent for identification by PCR sequential analysis to Bhat biotech, Bengaluru. Two samples were submitted for identification by colony morphology and compared with known organism from the literature.²⁵

Fermentation of Isolated Fungi

Fermentation of isolated fungi were carriedout in 3 liters of PDB solution in Erlenmeyer flask and incubated at 25-26^o C under asceptic situation for 21 days. Fungal broth was washed through four layers of cheese cloth and homogenized to distinguish mycelia from broth at 4000 rpm.

Extraction of Fungal Broth with Non-Polar Organic Solvents

Extraction of fermented fungal broth was carried outusing ethyl acetate and n-butanol using separating funnel. Organic phase was removed by rotary flash evaporator and concentrated to form coarse residue. All the crude fractions were weighed and calculated to know the % yield of each fractions.²⁶ Based on the results of phytochemical analysis and thin layer Chromatographic studies, the ethyl acetate and n-butanol endophytic fungal extracts of Bacopa monnieriwere further screened for in vitro antioxidant activity. 

Phytochemical Analysis

Qualitative chemical analysis and thin layer chromatographic studies were carried out to know the important phytoconstituents present in the ethyl acetate and n-butanol endophytic fungal extracts of Bacopa monnieri. 

Phenotypic Identification 

The colonies cultivated on the agar plate were analyzed with colony features and by lactophenol staining. 

ColonyMorphology

The Lacto phenol cotton blue staining were studied using colonies cultivated on the agar plate.

Lacto Phenol Cotton Blue Staining

A few drops of Lacto phenol cotton blue stain (HiMedia) was placed in the center of the cleanglass slide. With a sterile cooled loop, the mycelia was transferred to the slide and teased gently. A clean cover slip was placed on it without air bubble. Using a blotting paper the excess stain was removed. Slide was visualized under high lens microscope. 

Molecular Identification

Colony PCR

To avoid any laboratory contamination, the PCR was performed on colonies picked directly from the agar plate.

Gel extraction

The PCR products from ITS gene PCR reactions were purified to remove unincorporated DNTPS and primers before sequencing using PCR purification kit (Geneasy Gel Elution Kit, Bhat Biotech India Pvt Ltd, Bengaluru).

Sequencing

Both strands of the ITS rDNA region amplified by PCR were sequenced by automated DNA sequence -3037xl DNA analyzer from Applied Biosystems using BigDye® Terminator v3.1 cycle sequencing Kit (Applied Biosystems). Sequence data were aligned and dendrograms were generated using Sequence analysis software version 5.2 from Applied Biosystems.

Phylogenetic analysis

Ten similar neighbors were aligned using CLUSTAL W2 software. The multiple-alignment file thus obtained was then used to create a Phylogram using the MEGA 5 software.

In Vitro Free Radical Scavenging Activity

Ferrous reducing antioxidant capacity assay (Reducing power assay)

Sample ferrous antioxidant reduction capability (FRAC) was assessed using the Oyaizu²⁶ technique. Fe²⁺ can be tracked by assessing the development of Perl's Prussian blue at 700 nm. Samples of 0.25 mL/standard solution at different concentrations (50–450 μg/mL), 0.625 mL of magnesium buffer (0.2 M) and 0.625 mL of 1% potassium ferricyanide solution[K3Fe(CN)6] were introduced to the sample collectors. To complete the reaction, the reaction mixtures were incubated at 50 ° C for 20 minutes. In the sample pipes, 0.625 mL of 10% trichloro acetic acid (TCA) gel was introduced. The complete combination was centrifuged for 10 min at 3000 rpm, after which 1.8 mL of supernatant was removed from the sample pipes and blended with 1.8 mL of distilled air and 0.36 mL of 0.1% ferric oxide solution (FeCl₃ ). The solution's absorbance was evaluated at 700 nm using an empty spectrophotometer. A typical blank solution contained the same solution mixture and was incubated under the same conditions. The blank solution's absorbance was evaluated at 700 nm. Ascorbic acid has been used as a standard. Increased response showed enhanced capability reduction. At each level, the experiment was reiterated three times.

DPPH radical scavenging assay

DPPH radical scavenging test, as outlined by Blois and Desmarchelier et al, evaluated for free radical scavenging capacity of the specimens.²⁷ The capacity of the plant extractives to donate hydrogen atom was determined by the decoloration of 2,2-diphenyl-1-picrylhydrazyl (DPPH) methanol fluid. In methanol bath, DPPH generates violet / purple dye and changes to purple colour tones in the existence of antioxidants. A sample of 0.1 mM DPPH was formulated in methanol and 2.4 mL of this product was blended at distinct levels (20–100 μg/mL) with 1.6 mL of methanol extract. The response combination was carefully vortexed and kept for 30 minutes in the dusk at RT. The blend absorbance was evaluated at 517 nm spectrophotometrically. Ascorbic acid has been used as a reference standard. The equation for calculating the percentage of DPPH radical scavenging operation:% DPPH Radical Scavenging Activity = {(A0 - A1)/A0} × 100. A0 is the control absorbance and A1 is the extractive / standard absorbance. Then percentage of inhibition against intake was displayed and calculated from the IC₅₀ graph. At each volume, the test was run three occasions.

Hydroxyl radical scavenging activity

The Halliwell et al technique determined the hydroxyl radical scavenging function of the extractives²⁷(100-500µg/mL). The Fe³⁺ -ascorbate-EDTA-H2O2 regime (Fenton response) produced hydroxyl radical. The test is based on the quantification of the 2-deoxy-d-ribose degradation material forming a purple chromogen when heated with TBA at high pH. The response combination produced 0.8 mL of water (50 mmol L−1, pH 7.4), 0.2 mL of extractives / standard at separate concentrations (100–500 μg/mL), 0.2 mL of EDTA (1.04 mmol L−1), 0.2 mL of FeCl₃ (1 mmol L−1) and 0.2 mL of2-deoxy-d-r) The mixtures were kept at 37 ° C in a heat tub and the response began with the addition of 0.2 mL of ascorbic acid, (2 mmol L −1) and 0.2 mL of H2O2 (10 mmol L−1). TBA (10 g L−1) was added to the reaction mixture after incubation at 37 ° C for 1 h, 1.5 mL of freezing thiobarbituric acid, accompanied by 1.5 mL of HCl. The mixture was heated for 15 min at 100 °C and then cooled with water. The solution absorbance was evaluated with a spectrophotometer at 532 nm. The hydroxyl radical scavenging capability was assessed with the inhibition of the 2-deoxy-d-ribose oxidation proportion of hydroxyl radicals. Mannitol were used as standard. % of radical hydroxyl scavenging operation was calculated using the formula :% hydroxyl radical scavenging activity = [A0 - (A1 - A2] × 100/A0:A0 is the sample-free absorption of command. A1 is the sample absorption and2-deoxy-D-ribose. A-2 is the sample's absorption without2-deoxy-d-ribose. Then percentage of inhibition against intake was displayed and calculated from the IC₅₀ graph. At each volume, the test was run for three occasions.

Results and Discussion

The plant Bacopa monnieri were collected in and around Dharwad district near lakes and were authenticated by botanist Dr. S.S. Hebbar Department of Botany, Govt. Science College, Dharwad and herbarium specimen were kept in our pharmacognosy department (SETCPD/REF/ 34/2018/19). Further isolation of endophytic fungi from leaves of the plant were carried out using Potato dextrose agar media followed by subculturing technique for a period of seven days to get a pure strain of fungi. Two fungal samples BMLF-1 and BMLF-2 were sent to Bhat Biotech Pvt. Ltd., Electronic City, Bengaluru for colony morphology and PCR sequential analysis for fungal identification. For identification of endophytic fungi, the phenotypic identification, were carried out and the features of the literature were compared with the recognized species. In colony morphology, the characteristics of the literature were compared with the known organisms whereas in lactophenol cotton blue staining,the slide was visualized under low to high power objectives of microscope which showed bluish and greenish colour fungal filaments as shown in Fig. 1 and Fig. 2. Further in the molecular identification, Species level identification was performed through the sequencing of the housekeeping ITS region 5.8s rRNA gene. Gel extractions of the PCR product was carried out to remove unincorporated DNTPS and were further purified. In sequencing, both strands of the ITS rDNA region were amplified by PCR as shown in Fig.3. The sequences thus obtained for plus and minus strands were aligned using appropriate software. In phylogenetic analysis, sequences were compared to the non-redundant NCBI database using blast analysis, with the default settings used to find sequences closest to each other. The expected value and e values were noted for the most similar sequences. Results of PCR Sequence analysis for RSCP1-1 and II (BMLF-) were represented as

RSCP1-1 ITS1 F(BMLF-1)

CACCCGTGAATACTAAACACTGTTTGCTTCGGCGGAGATCCCCCCCGGGGGTGACCGCCGGAGACCACTGAACTTCTTTGTTTAAGCATGATCTCTGAGCTTTAATAAGCAAATTGATTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGCGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCATCAAGCGCGGCTTGTGTGTTGGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGTACCGTCCGGTCCTCGAGCGTATGGGAGCTTTGTCACCCGCTCGATTAGGGTCCGGTCGGCGCTAGCCGTCAACCCCCAATTTTATTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTACAGCATATCAATAAGCGCGAGCGA

RSCP-2-1 ITS4 R (BMLF-2)

CCTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGTGCGGGTTGCCCTCGGGCACCCAACCTCCCACCCGTGAATACTAAACACTGTTGCTTCGGCGGAGATCCCCCCCGGGGGTGACCGCCGGAGACCACTGAACTTCTTTGTTTAAGCATGATCTCTGAGCTTTAATAAGCAAATTGATTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAACTGCGATAAGTAATGCGAATTGCAGAATTCAGTGA

Bacopa monnieri

From the colony morphology and PCR sequential analysis, the isolated endophytic fungal samples (Fig.1and 2) and (Table1 and 2) of BMLF were identified as Aspergillus aeneus NRRL 4769 and Aspergillus aeneus strain aae-⁴⁸.

Fermentation of pure strains of isolated fungi were carriedout in three litres of potato dextrose broth solution in Erlenmeyer flask and incubated at 25-26oCfor 21days and filtered to separate mycelia. Further extraction of fungalbroth were carried out using non-polar organic solvents chloroform, ethylacetate and n-butanol. The organic phase were dried and % yield were found to be 3.5, 4.5, and 5.0g, respectively.Preliminary phytochemical analysis and thin layer chromatographic studies of chloroform, ethylacetate, and n-butanol extracts of leaf of Bacopa monnieri showed the presence of alkaloids and steroids in chloroform,ethylacetate, and n-butanol extracts revealed tannins and flavonoids. The plant's ethylacetate endophytic fungal extracts showed stronger antioxidant efficacy relative to n-butanol extracts in all the in vitro models studied. Antioxidants are substances that protects the cell against the effects of free radicals. Free radicals are molecules which are produced when body breaks down food or exposed to tobacco, smoke, and radiation. Free radicals can damage cells and may play a role in heart disease, cancer, stress, neurological disorders, etc. Studies suggest that high diet antioxidants from plant source is associated with low risk of these diseases and also protects against the diseases which are caused due to oxidative stress.The presence of antioxidants in medicinal plants can play a major role in preventing oxidative stress and protecting biochemical functions of essential antioxidants.^28-30 Reducing power of endophytic fractions of Bacopa monnieri leaf (BMLF-1) (50-450µg/mL) strengthens as concentration increases. Ethyl acetate extracts of BMLF-1 showed better reduction capacity relative to other extracts. Fe (III) decrease is often used in this assay as an important measure of electron donation behavior that is an important method of phenolic antioxidant intervention by donating a H2 atom. The ethyl acetate extract displayed the greatest dose-dependent performance as shown (Table3, Fig. 4). DPPH radical’s reactionwithBMLF-1 (20-200 µg/mL) exhibited good scavenging activity.IC₅₀ values of Ascorbicacid, ethylacetate extract, and n-butanol extractaretraced out as^30.33, 117.79, and 102.89 µg/mL, respectively. As per the equation Y=mX+C, the values for y= 1.9632x + 11.876, y = 0.272x + 17.96, y = 0.256x + 23.66 and the values for R2=0.9991, 0.994, and 0.998as shown in (Table 4, Figure 5 and 6). Ethylacetate andn-butanol extract activity for BMLF-1(100-500 µg/mL) revealed scavenging dependent concentration in hydroxyl radical generated in a response of Fenton reaction. This test demonstrates the ability of the extract and normal mannitol to prevent hydroxyl radical-mediated deoxyribose degradation in a response combination of Fe3 + -EDTA-mannitol and H₂ O₂ . IC₅₀ values for mannitol, ethylacetateextract and n-butanolextract found to be 116.45, 154.85, and 203.49 µg/mL,respectively. As per the equation Y=mX+C, the values for y =0.079x + 40.80, y =0.070x + 39.16 and y= 0.063x + 37.18 and the values for R2=0.954, 0.993, and 0.999as shown in (Table 5, Figure 7). Endophytic ethylacetate fungal extracts exhibited prominent free radical scavenging activity in the tested in vitro models compared to other extract. Polyphenols are the most significant compounds for the antioxidant properties. The antioxidant activity of polyphenols is mainly due to their redox potential, which allow them to act as reducing agents, hydrogen donors, singlet oxygen quenchers, metal chelators, etc. Different parts of medicinal plants are rich in phenolic compounds such as phenolic acids,stilbenes, tannins, flavonoids, coumarins, lignins which have several therapeutic effects along with their antioxidant capacity.^31-32

Therefore there is need of potential antioxidants from endophytic community as an alternative source to allopathic drugs for the prevention of diseases which are caused by the liberation of free radicals or due to oxidative stress which occur in our day today life.

Conclusion

In our present investigations, endophytic fungal extracts of ethylacetate and n-butanol of leaves of Bacopa monnieri showed potential antioxidant activity in all the tested in vitro free radical scavenging activities. The activity may be due to presence of tannins, flavonoids, alkaloids, and steroids in the endophytic fungal extracts of leaf of Bacopa monnieri. Further investigations are required to isolate and characterize the polyphenolic compounds which are present in the endophytic fungal extracts of the plant responsible for antioxidant activity and in the management of free radicals.

Conflict of Interest

The authors declare no conflict of interest.

Acknowledgements

The authors are grateful to the President, Dr. Dambal HV and Principal Dr. Kulkarni VH, SET’s Pharmacy College, S.R.Nagar, Dharwad for providing required facilities for the study.

Funding Source

The researchers are grateful to Rajiv Gandhi University of Health Sciences, Jayanagar, Bengaluru (Ref. No: RGU / ADV.RES / GRANTS/059/2016-17) for funding the project.