Molecular Analysis of Streptococcus Mutans associated with Dental Caries in Bangalore Urban Population

INTRODUCTION

Micro-organisms start to colonize the human oral cavity at birth, and the process continues as the child develops¹. The establishment of streptococcus mutans has received special attention because of their cariogenic activity¹. Mutans streptococci have been strongly associated with the initiation of caries². Mutans streptococci have been well known as group of oral microorganisms which have virulence factors related to cariogenicity³. They drop the plaque pH to low levels by by producing acids from carbohydrates and survive in this acidic environment³. They also produce extracellular polysaccharides which may promote the dissolution of the tooth surfaces by increasing the porosity of plaque matrix and permitting deeper penetration of sugars³. It is now evident that that knowledge of this bacteria enforces empirical approach to therapy rather than specific antimicrobial therapy that might allow more conservative treatment options⁴. The principle of bacterial cultivation and identification is known as phenotypic methods⁵. These methods analyze readily observable bacterial traits and behavior. Explosion in molecular biology over the past 20 years has provided alternatives to phenotype-based strategies used in clinical microbiology⁵. The detection and manipulation of nucleic acids(DNA and RNA) allows microbial genes to be examined directly, that is genotypic methods⁵. Among the latest molecular diagnostic methods, polymerase chain reaction(PCR) is gold standard⁵. Proper exploiting of this molecular technology to composition of microbiota provides valuable information regarding identification and better understanding of causative factor to enhance high success rate in treatment⁵. Mutans streptococci species are known to show high levels of genotypic diversity⁶. This prompted us to Analyze Streptococcus mutans associated with Dental Caries in Bangalore Urban Population.

The aims and objectives were to obtain the genomic DNA from clinical isolates of streptococcus mutans and its analysis, and to screen the genomic DNA band pattern targeting the dex gene by PCR-RFLP studies.

METHODOLOGY

Isolation of Strains:

Dental Plaque samples were collected at the M. S. Ramaiah Dental College. Prior consent was obtained from the patients visiting the institute. They were transported to the M. S. Ramaiah Institute of Technology Biotechnology Labs where they were isolated and identified.

The following protocols were followed for the isolation and identification of S. mutans Sample Inoculation, Using sterile cotton swab, the sample was inoculated into the plates containing Brain Heart Infusion media. The plates were kept at room temperature for 24 hours. They were then transferred to a CO₂ incubator, where they were incubated at 37^o C in a 10% CO₂ environment for 48 hours.Isolation of Streptococcus mutans : Mitis salivarius agar was autoclaved separately at 121^o C for 20 min, and allowed to cool to 50-55^o C before adding 1.0 ml of 1 % potassium tellurite (Hi-media) and 2.4 mg of o bacitracin (Hi-media). After thorough stirring at 55^o C, it was poured into the plates.Using a sterile loop, a single colony was selected from the growth media and sub-cultured into the selective media. Maintenance of Culture, Revival of Standard Strain Standard lyophilized cultures were procured from The Microbial Type Culture Collection & Gene Bank (MTCC), Chandigarh, namely Streptococcus mutans MTCC 497. These cultures were revived using TH broth. After appropriate growth, the standard was subcultured and maintained at low temperature.

Demonstration of Genomic DNA using Agarose Gel Electrophoresis :

Materials: Tris-Acetate EDTA Buffer (TAE) (10X; pH 8.2), Mix Tris-Base (24.20 g), 0.5 M EDTA Na₂ (10 ml) and Glacial Acetic acid 5.72 ml. Make up volume with double distilled water to 100 ml. 0.8 % Agarose. Gel-loading Solution (Sucrose 30 %, Bromophenol blue 0.25 % and Xylene cyanol FF 0.25 % (all w/v) in single-strength TAE buffer).

Procedure : 50 ml of 0.8 % agarose solution containing 2 µl of Ethidium Bromide maintained at 50 °C was poured into the casting gel tank. A suitable well-forming comb was placed about 1cm from the cathode, without the teeth of comb touching the glass plate. The gel was allowed to set for 1 hour. Single-strength TAE buffer was poured into the tank until the gel (including zinc oxide wall) is submerged. The electrodes were connected to the power supply with the cathode (-ve) at the well end of the gel. DNA samples (5-20 µl) were added and standard taken in gel-loading solution using a micropipette. The power supply was turned on and the gel was run at 50 V (5–7.5 mA). The progress of fast-running (bromophenol blue) tracking dye during electrophoresis, was monitored. The run was terminated when the tracking dye was about to leave the gel. The gel was transferred onto a thick plastic sheet, & placed on a UV transilluminator and viewed under ultraviolet light (300 nm). Nucleic acids on the gel appear orange owing to the fluorescence of bound ethidium bromide.

PCR-RFLP Analysis : PCR (Polymerase chain reaction)

Principle: PCR is a technique to amplify a single or few copies of a piece of DNA generating more copies of a particular DNA sequence. The dex gene from S. mutans is considered. The N and C terminal regions of dex gene are subjected to amplification. The oligonucleotide primers (Sigma Aldrich) are designed to be complimentary to the ends of the sequences to be amplified. The Forward primer sequence TATTCSGCTTAGAAATTAA and the reverse primer sequence GCAAGTTCTTCAGCTTGTTTT is derived from the dex gene.

Procedure: PCR was carried out in following steps:

All the components were added in Eppendorf tubes and a layer of paraffin oil was added on top of the mixture to prevent evaporation. PCR was carried out by placing the vials in a thermocycler. The parameters were set for the required amplification of the DNA.

RFLP (Restriction Fragment Length Polymorphism) : It is a variation in the DNA sequence of a genome that can be detected by breaking the DNA into pieces with restriction enzymes and analyzing the size of the resulting fragments by gel electrophoresis. The basic technique for detecting RFLPs involves fragmenting a sample of DNA by a restriction enzyme, which can recognize and cut DNA wherever a specific short sequence occurs, in a process known as a restriction digest. The resulting DNA fragments are then separated by length through PAGE (Polyacrylamide Gel Electrophoresis).Materials : Sterile Eppendorf tubes, Components of RFLP (1X Assay buffer for HindIII - Tris HCl (10 mM), NaCl (50 mM), MgCl₂ (10 mM), DTT (1 mM) of pH 7.8)

Procedure: The vials were placed at 37 C for 4 hours. The reaction was arrested by using gel loading buffer containing EDTA, which chelates Mg ions, which were required for enzyme activity.

RESULTS

Out of 100 samples, 56 were isolated and identified as positive and used for this study, along with the MTCC standard.

Revival of Standard Strain and Maintenance of Isolates Standard Lyophilized culture of Streptococcus mutans MTCC 497 was revived in TH broth successfully and maintained. Todd Hewitt Agar slants were used as the best medium for storing the cultures of each isolate. They were regularly subcultured in TH broth and fresh cultures were grown on TH Agar slants.

Demonstration of Genomic DNA using Agarose Gel Electrophoresis: Single band of high molecular weight DNA was observed in all the isolates and one standard (MTCC497). RNA was visibly absent from the bands

Polymerase Chain Reaction (PCR): The PCR products loaded on 1.5 % agarose gel, showed one type of band. The bands were analyzed using DGelDAS, which showed that the bands sizes were ≈ 520-bp to 570-bp. The sizes of PCR products were compared with 600-bp molecular weight DNA ladder

Restriction Fragment Length Polymorphism (RFLP) : The amplified products were successfully restricted with HaeIII. The restriction digested PCR amplicons were loaded on 1.5% agarose gel. All the samples gave bands whose molecular sizes were compared with the 100 bp DNA ladder. The band pattern did not show much of heterogeneity. Digestion was carried out with HindIII, PvuII, PstI and EcoRI, all of which proved to be unsuccessful, as they showed no fragment bands.

DISCUSSION

Literature reveals extensive and intensive research has been done on serotypes, gene cloning, molecular sequencing and the prevalence of heterogenecity in streptococcus mutans in Japan, United kingdom, USA, and European countries^1,2. Activity of free, extracellular dextranase inhibitors is controlled by the extent of binding to dextranase and the extent of adsorption to water-insoluble α-D-Glucans⁷. Analysis of independent isolates of S.Mutans by techniques RFLP, Ribo-typing or AP-PCR has shown a high degree of diversity within the species⁸. These methods have also been of value in genetic fingerprinting⁸. Mutans streptococci remains permanently in the oral flora after either the primary acquisition of mutans strains or at a later age⁹. Different genotypes indicated that colonizing types may persist for several years⁹. DNA finger printing demonstrated the transmission and acquisition of S.Mutans within family cohorts and to examine the conservation of strains as a function of time within a family of bacterial species¹⁰. Analysis of S.Mutans serotype-C isolates indicated that tha spaP gene is highly conserved, with the exception of variable region differences first identified by comparing spaP and PAC sequences¹¹. No particular genotype of S.Mutans is uniquely associated with the initiation and progression of caries, and that root and coronal caries can emerge in the presence of broad spectrum of S.Mutans clones¹². Plaque acidogenicty was more pronounced for high-mutans streptococci group compared to the low-mutans streptococci group after a short term sucrose exposure¹³. There has been much debate about the strength of the association between mutans streptococci and initiation of dental caries¹⁴. Several new selective mediums have been developed for S.Mutans for determining the prevalence of predominant species^15,16.

In our study the samples were first collected using sterile toothpicks. From these samples the isolation and identification of S. mutans strains was carried out as per the standard protocols. The isolated positive strains were then regularly sub-cultured and maintained on TH agar slants. Overnight TH broth cultures were used for total DNA content isolation. Lysis of cell wall was achieved by Centrifugation with Tris Buffers treatment followed by heat treatment. DNA was extracted using Ethanol. The genomic DNA samples showed no contamination with RNA as opposed to the Phenol Chloroform method used in previous studies. dex gene of the genomic DNA of all samples were amplified by PCR using the dex gene primers. The PCR products were directly stored. Further RFLP performed with various restriction enzymes. Digestion with HaeIII succeeded but yielded almost no heterogeneity in the fragments. There was no visible digestion seen with the use of other enzymes such as HindIII, PvuII, PstI and EcoRI.

CONCLUSION

Dental caries is one of the most common infectious diseases of mankind. Streptococcus mutans has been implicated as cariogenic bacteria because they produce high levels of lactic acid and extracellular polysaccharide. An exhaustive literature review showed that no studies had been done on the domain of dental caries in the Bangalore urban populace.

The isolation of S. mutans was done by standard biochemical tests and fermentation studies. Genomic DNA from all the isolates and standard (MTCC 497) was obtained and subjected further for PCR-RFLP analysis targeting the dex gene. HaeIII enzyme successfully digested the PCR amplicons but the fragments had no visible heterogenicity.

ACKNOWLEDGEMENTS

We Acknowledge Rajiv Gandhi University of Health Sciences, Bangalore, R&D wing for the financial support. Dr.M.V.Nagaraja Setty and Dr. Dhamodhar from Dept of Biotechnology, M.S.Ramaiah Institute of Technology for their support and help during the project.